Review



resource source identifier mouse ifnγ elispot fisher scientific  (Fisher Scientific)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Fisher Scientific resource source identifier mouse ifnγ elispot fisher scientific
    Resource Source Identifier Mouse Ifnγ Elispot Fisher Scientific, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+mouse+ifn%CE%B3+elispot+fisher+scientific/ifn+%CE%B2/pm42102812-773-2-8
    Average 86 stars, based on 1 article reviews
    resource source identifier mouse ifnγ elispot fisher scientific - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Enzyme-linked Immunospot:

    Article Title: Dendritic cell redundancy enables priming of anti-tumor CD4 + T cells in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45 PE-CF594 BD Biosciences Cat# 562279; RRID: AB_11154577 anti-CD34 Brilliant Violet 510 BioLegend Cat# 343528; RRID: AB_2563856 anti-CD20 Pacific Blue BioLegend Cat# 302328; RRID: AB_1595435 anti-CD3 Pacific Blue BioLegend Cat# 300418; RRID: AB_493095 anti-CD14 Pacific Blue BioLegend Cat# 301828; RRID: AB_2275670 anti-CD16 Pacific Blue BioLegend Cat# 302032; RRID: AB_2104003 anti-CD19 Pacific Blue BioLegend Cat# 302232; RRID: AB_2073118 anti-HLA-DR Brilliant Violet 711 BioLegend Cat# 307643; RRID: AB_11218794 anti-CD45RA PE-Cy7 BioLegend Cat#304126; RRID: AB_10708879 anti-CD33 FITC BioLegend Cat# 366620; RRID: AB_2566422 anti-CD123 Brilliant Violet 605 BD Biosciences Cat# 740412; RRID: AB_2740142 anti-CADM1 Alexa Fluor 647 MBL International Cat# CM004-A64; RRID: AB_3107120 anti-CD1c PE BioLegend Cat# 331506; RRID: AB_1088999 Bacterial and virus strains DH5α Life Technologies Cat# 18265017 Biological samples Human PDAC Tissue This paper Human PDAC patient blood This paper Chemicals, peptides, and recombinant proteins STING agonist Bristol Myers Squibb BMS-986301 BsmBI NEB Cat# R0739S BbsI NEB Cat# R3539S T4 DNA ligase NEB Cat# M0202L Lipofectamine ThermoFisher Cat# 13778075 OptiMEM Life Technologies Cat# 31985062 Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 FTY720 Sigma Cat# SML0700 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 IFNγ Peprotech Cat# 315-05 ІFNβ BioLegend Cat# 581302 IFNα BioLegend Cat# 752804 Qiagen RNAeasy Plus Mini Kit Qiagen Cat# 74134 hIL-2 Peprotech Cat# 200-02 ISQAVHAAHAEINEAGR in-house generated TAPDNLGYM (M9) Clancy-Thompson et al.70 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD8 Negative Selection Kit STEMCELL Cat# 19853 Brefeldin A Sigma Cat# B7651 Collagenase IV Sigma Cat# C5138 Soybean trypsin inhbitor Life Technologies Cat# 17075029 Tumor dissociation kit Miltenyi Cat# 130-095-929 Critical commercial assays Micro BCA Kit Fisher Scientific Cat# PI23235 (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–20.e1–e9, July 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFNγ ELISpot Fisher Scientific Cat# BDB551083 Mouse IFNα ELISA Life Technologies Cat# BMS6027 Deposited data Loveless et al. data Loveless et al.74 https://zenodo.org/records/14199536 Hwang et al. data Hwang et al.75 GEO# GSE202051 DFCI human single-cell RNA sequencing This paper dbGAP: phs004508 dbGAP: phs004257 Mouse single-cell and bulk RNA sequencing This paper GEO: GSE325195 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM31 Mouse: 6419c5 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM21 Mouse: 6694c2 β2m− /− Roehle et al.56 Mouse: 6694c2 Ciita− /− This paper Mouse: 6694c2 Caspase-8− /− This paper Mouse: 6694c2COVA This paper Mouse 6694c2 Stat1− /− This paper Mouse: 6694c2 Ifnγr1− /− This paper Mouse: 6694c2-met Qiang et al.58 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory Cat# 000664 Mouse: μMT − /− The Jackson Laboratory Cat# 002249 Mouse: Batf3 − /− The Jackson Laboratory Cat# 013755 TCRα − /− The Jackson Laboratory Cat# 002116 β2M − /− The Jackson Laboratory Cat# 002087 I-Ab − /− The Jackson Laboratory Cat# 005589 Rag2 − /− The Jackson Laboratory Cat# 008449 Ifnγ − /− The Jackson Laboratory Cat# 002287 Perforin-1 − /− The Jackson Laboratory Cat# 002407 Ifnar1 − /− The Jackson Laboratory Cat# 028288 Ccr2 − /− The Jackson Laboratory Cat# 004999 iNOS − /− The Jackson Laboratory Cat# 002609 ΔΔGata1 The Jackson Laboratory Cat# 005653 Δ1+2 + 3 The Jackson Laboratory Cat# 037704 OT-II The Jackson Laboratory Cat# 004194 TRP1high Dana-Farber Cancer Institute (bred in-house) RRID:IMSR_JAX:030958 TCRδ− /− The Jackson Laboratory Cat# 002120 Mr1− /− TCRδ− /− Dana-Farber Cancer Institute (bred in-house) CD11ccre The Jackson Laboratory Cat# 008068 LysMcre The Jackson Laboratory Cat# 004781 MHC-IIfl/fl The Jackson Laboratory Cat# 037709 CD11ccre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) LysMcre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) Tbx21− /− The Jackson Laboratory Cat# 004648 Oligonucleotides Caspase-8 sgRNA Doench et al.89 CAAGAAGCAGGAGACCATCG (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–20.e1–e9, July 13, 2026 e3 ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Dendritic cell redundancy enables priming of anti-tumor CD4 + T cells in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45 PE-CF594 BD Biosciences Cat# 562279; RRID: AB_11154577 anti-CD34 Brilliant Violet 510 BioLegend Cat# 343528; RRID: AB_2563856 anti-CD20 Pacific Blue BioLegend Cat# 302328; RRID: AB_1595435 anti-CD3 Pacific Blue BioLegend Cat# 300418; RRID: AB_493095 anti-CD14 Pacific Blue BioLegend Cat# 301828; RRID: AB_2275670 anti-CD16 Pacific Blue BioLegend Cat# 302032; RRID: AB_2104003 anti-CD19 Pacific Blue BioLegend Cat# 302232; RRID: AB_2073118 anti-HLA-DR Brilliant Violet 711 BioLegend Cat# 307643; RRID: AB_11218794 anti-CD45RA PE-Cy7 BioLegend Cat#304126; RRID: AB_10708879 anti-CD33 FITC BioLegend Cat# 366620; RRID: AB_2566422 anti-CD123 Brilliant Violet 605 BD Biosciences Cat# 740412; RRID: AB_2740142 anti-CADM1 Alexa Fluor 647 MBL International Cat# CM004-A64; RRID: AB_3107120 anti-CD1c PE BioLegend Cat# 331506; RRID: AB_1088999 Bacterial and virus strains DH5α Life Technologies Cat# 18265017 Biological samples Human PDAC Tissue This paper Human PDAC patient blood This paper Chemicals, peptides, and recombinant proteins STING agonist Bristol Myers Squibb BMS-986301 BsmBI NEB Cat# R0739S BbsI NEB Cat# R3539S T4 DNA ligase NEB Cat# M0202L Lipofectamine ThermoFisher Cat# 13778075 OptiMEM Life Technologies Cat# 31985062 Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 FTY720 Sigma Cat# SML0700 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 IFNγ Peprotech Cat# 315-05 ІFNβ BioLegend Cat# 581302 IFNα BioLegend Cat# 752804 Qiagen RNAeasy Plus Mini Kit Qiagen Cat# 74134 hIL-2 Peprotech Cat# 200-02 ISQAVHAAHAEINEAGR in-house generated TAPDNLGYM (M9) Clancy-Thompson et al.70 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD8 Negative Selection Kit STEMCELL Cat# 19853 Brefeldin A Sigma Cat# B7651 Collagenase IV Sigma Cat# C5138 Soybean trypsin inhbitor Life Technologies Cat# 17075029 Tumor dissociation kit Miltenyi Cat# 130-095-929 Critical commercial assays Micro BCA Kit Fisher Scientific Cat# PI23235 (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–20.e1–e9, July 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFNγ ELISpot Fisher Scientific Cat# BDB551083 Mouse IFNα ELISA Life Technologies Cat# BMS6027 Deposited data Loveless et al. data Loveless et al.74 https://zenodo.org/records/14199536 Hwang et al. data Hwang et al.75 GEO# GSE202051 DFCI human single-cell RNA sequencing This paper dbGAP: phs004508 dbGAP: phs004257 Mouse single-cell and bulk RNA sequencing This paper GEO: GSE325195 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM31 Mouse: 6419c5 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM21 Mouse: 6694c2 β2m− /− Roehle et al.56 Mouse: 6694c2 Ciita− /− This paper Mouse: 6694c2 Caspase-8− /− This paper Mouse: 6694c2COVA This paper Mouse 6694c2 Stat1− /− This paper Mouse: 6694c2 Ifnγr1− /− This paper Mouse: 6694c2-met Qiang et al.58 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory Cat# 000664 Mouse: μMT − /− The Jackson Laboratory Cat# 002249 Mouse: Batf3 − /− The Jackson Laboratory Cat# 013755 TCRα − /− The Jackson Laboratory Cat# 002116 β2M − /− The Jackson Laboratory Cat# 002087 I-Ab − /− The Jackson Laboratory Cat# 005589 Rag2 − /− The Jackson Laboratory Cat# 008449 Ifnγ − /− The Jackson Laboratory Cat# 002287 Perforin-1 − /− The Jackson Laboratory Cat# 002407 Ifnar1 − /− The Jackson Laboratory Cat# 028288 Ccr2 − /− The Jackson Laboratory Cat# 004999 iNOS − /− The Jackson Laboratory Cat# 002609 ΔΔGata1 The Jackson Laboratory Cat# 005653 Δ1+2 + 3 The Jackson Laboratory Cat# 037704 OT-II The Jackson Laboratory Cat# 004194 TRP1high Dana-Farber Cancer Institute (bred in-house) RRID:IMSR_JAX:030958 TCRδ− /− The Jackson Laboratory Cat# 002120 Mr1− /− TCRδ− /− Dana-Farber Cancer Institute (bred in-house) CD11ccre The Jackson Laboratory Cat# 008068 LysMcre The Jackson Laboratory Cat# 004781 MHC-IIfl/fl The Jackson Laboratory Cat# 037709 CD11ccre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) LysMcre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) Tbx21− /− The Jackson Laboratory Cat# 004648 Oligonucleotides Caspase-8 sgRNA Doench et al.89 CAAGAAGCAGGAGACCATCG (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–20.e1–e9, July 13, 2026 e3 ..

    Single Cell:

    Article Title: Dendritic cell redundancy enables priming of anti-tumor CD4 + T cells in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45 PE-CF594 BD Biosciences Cat# 562279; RRID: AB_11154577 anti-CD34 Brilliant Violet 510 BioLegend Cat# 343528; RRID: AB_2563856 anti-CD20 Pacific Blue BioLegend Cat# 302328; RRID: AB_1595435 anti-CD3 Pacific Blue BioLegend Cat# 300418; RRID: AB_493095 anti-CD14 Pacific Blue BioLegend Cat# 301828; RRID: AB_2275670 anti-CD16 Pacific Blue BioLegend Cat# 302032; RRID: AB_2104003 anti-CD19 Pacific Blue BioLegend Cat# 302232; RRID: AB_2073118 anti-HLA-DR Brilliant Violet 711 BioLegend Cat# 307643; RRID: AB_11218794 anti-CD45RA PE-Cy7 BioLegend Cat#304126; RRID: AB_10708879 anti-CD33 FITC BioLegend Cat# 366620; RRID: AB_2566422 anti-CD123 Brilliant Violet 605 BD Biosciences Cat# 740412; RRID: AB_2740142 anti-CADM1 Alexa Fluor 647 MBL International Cat# CM004-A64; RRID: AB_3107120 anti-CD1c PE BioLegend Cat# 331506; RRID: AB_1088999 Bacterial and virus strains DH5α Life Technologies Cat# 18265017 Biological samples Human PDAC Tissue This paper Human PDAC patient blood This paper Chemicals, peptides, and recombinant proteins STING agonist Bristol Myers Squibb BMS-986301 BsmBI NEB Cat# R0739S BbsI NEB Cat# R3539S T4 DNA ligase NEB Cat# M0202L Lipofectamine ThermoFisher Cat# 13778075 OptiMEM Life Technologies Cat# 31985062 Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 FTY720 Sigma Cat# SML0700 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 IFNγ Peprotech Cat# 315-05 ІFNβ BioLegend Cat# 581302 IFNα BioLegend Cat# 752804 Qiagen RNAeasy Plus Mini Kit Qiagen Cat# 74134 hIL-2 Peprotech Cat# 200-02 ISQAVHAAHAEINEAGR in-house generated TAPDNLGYM (M9) Clancy-Thompson et al.70 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD8 Negative Selection Kit STEMCELL Cat# 19853 Brefeldin A Sigma Cat# B7651 Collagenase IV Sigma Cat# C5138 Soybean trypsin inhbitor Life Technologies Cat# 17075029 Tumor dissociation kit Miltenyi Cat# 130-095-929 Critical commercial assays Micro BCA Kit Fisher Scientific Cat# PI23235 (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–20.e1–e9, July 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFNγ ELISpot Fisher Scientific Cat# BDB551083 Mouse IFNα ELISA Life Technologies Cat# BMS6027 Deposited data Loveless et al. data Loveless et al.74 https://zenodo.org/records/14199536 Hwang et al. data Hwang et al.75 GEO# GSE202051 DFCI human single-cell RNA sequencing This paper dbGAP: phs004508 dbGAP: phs004257 Mouse single-cell and bulk RNA sequencing This paper GEO: GSE325195 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM31 Mouse: 6419c5 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM21 Mouse: 6694c2 β2m− /− Roehle et al.56 Mouse: 6694c2 Ciita− /− This paper Mouse: 6694c2 Caspase-8− /− This paper Mouse: 6694c2COVA This paper Mouse 6694c2 Stat1− /− This paper Mouse: 6694c2 Ifnγr1− /− This paper Mouse: 6694c2-met Qiang et al.58 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory Cat# 000664 Mouse: μMT − /− The Jackson Laboratory Cat# 002249 Mouse: Batf3 − /− The Jackson Laboratory Cat# 013755 TCRα − /− The Jackson Laboratory Cat# 002116 β2M − /− The Jackson Laboratory Cat# 002087 I-Ab − /− The Jackson Laboratory Cat# 005589 Rag2 − /− The Jackson Laboratory Cat# 008449 Ifnγ − /− The Jackson Laboratory Cat# 002287 Perforin-1 − /− The Jackson Laboratory Cat# 002407 Ifnar1 − /− The Jackson Laboratory Cat# 028288 Ccr2 − /− The Jackson Laboratory Cat# 004999 iNOS − /− The Jackson Laboratory Cat# 002609 ΔΔGata1 The Jackson Laboratory Cat# 005653 Δ1+2 + 3 The Jackson Laboratory Cat# 037704 OT-II The Jackson Laboratory Cat# 004194 TRP1high Dana-Farber Cancer Institute (bred in-house) RRID:IMSR_JAX:030958 TCRδ− /− The Jackson Laboratory Cat# 002120 Mr1− /− TCRδ− /− Dana-Farber Cancer Institute (bred in-house) CD11ccre The Jackson Laboratory Cat# 008068 LysMcre The Jackson Laboratory Cat# 004781 MHC-IIfl/fl The Jackson Laboratory Cat# 037709 CD11ccre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) LysMcre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) Tbx21− /− The Jackson Laboratory Cat# 004648 Oligonucleotides Caspase-8 sgRNA Doench et al.89 CAAGAAGCAGGAGACCATCG (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–20.e1–e9, July 13, 2026 e3 ..

    RNA Sequencing:

    Article Title: Dendritic cell redundancy enables priming of anti-tumor CD4 + T cells in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45 PE-CF594 BD Biosciences Cat# 562279; RRID: AB_11154577 anti-CD34 Brilliant Violet 510 BioLegend Cat# 343528; RRID: AB_2563856 anti-CD20 Pacific Blue BioLegend Cat# 302328; RRID: AB_1595435 anti-CD3 Pacific Blue BioLegend Cat# 300418; RRID: AB_493095 anti-CD14 Pacific Blue BioLegend Cat# 301828; RRID: AB_2275670 anti-CD16 Pacific Blue BioLegend Cat# 302032; RRID: AB_2104003 anti-CD19 Pacific Blue BioLegend Cat# 302232; RRID: AB_2073118 anti-HLA-DR Brilliant Violet 711 BioLegend Cat# 307643; RRID: AB_11218794 anti-CD45RA PE-Cy7 BioLegend Cat#304126; RRID: AB_10708879 anti-CD33 FITC BioLegend Cat# 366620; RRID: AB_2566422 anti-CD123 Brilliant Violet 605 BD Biosciences Cat# 740412; RRID: AB_2740142 anti-CADM1 Alexa Fluor 647 MBL International Cat# CM004-A64; RRID: AB_3107120 anti-CD1c PE BioLegend Cat# 331506; RRID: AB_1088999 Bacterial and virus strains DH5α Life Technologies Cat# 18265017 Biological samples Human PDAC Tissue This paper Human PDAC patient blood This paper Chemicals, peptides, and recombinant proteins STING agonist Bristol Myers Squibb BMS-986301 BsmBI NEB Cat# R0739S BbsI NEB Cat# R3539S T4 DNA ligase NEB Cat# M0202L Lipofectamine ThermoFisher Cat# 13778075 OptiMEM Life Technologies Cat# 31985062 Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 FTY720 Sigma Cat# SML0700 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 IFNγ Peprotech Cat# 315-05 ІFNβ BioLegend Cat# 581302 IFNα BioLegend Cat# 752804 Qiagen RNAeasy Plus Mini Kit Qiagen Cat# 74134 hIL-2 Peprotech Cat# 200-02 ISQAVHAAHAEINEAGR in-house generated TAPDNLGYM (M9) Clancy-Thompson et al.70 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD8 Negative Selection Kit STEMCELL Cat# 19853 Brefeldin A Sigma Cat# B7651 Collagenase IV Sigma Cat# C5138 Soybean trypsin inhbitor Life Technologies Cat# 17075029 Tumor dissociation kit Miltenyi Cat# 130-095-929 Critical commercial assays Micro BCA Kit Fisher Scientific Cat# PI23235 (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–20.e1–e9, July 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFNγ ELISpot Fisher Scientific Cat# BDB551083 Mouse IFNα ELISA Life Technologies Cat# BMS6027 Deposited data Loveless et al. data Loveless et al.74 https://zenodo.org/records/14199536 Hwang et al. data Hwang et al.75 GEO# GSE202051 DFCI human single-cell RNA sequencing This paper dbGAP: phs004508 dbGAP: phs004257 Mouse single-cell and bulk RNA sequencing This paper GEO: GSE325195 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM31 Mouse: 6419c5 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM21 Mouse: 6694c2 β2m− /− Roehle et al.56 Mouse: 6694c2 Ciita− /− This paper Mouse: 6694c2 Caspase-8− /− This paper Mouse: 6694c2COVA This paper Mouse 6694c2 Stat1− /− This paper Mouse: 6694c2 Ifnγr1− /− This paper Mouse: 6694c2-met Qiang et al.58 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory Cat# 000664 Mouse: μMT − /− The Jackson Laboratory Cat# 002249 Mouse: Batf3 − /− The Jackson Laboratory Cat# 013755 TCRα − /− The Jackson Laboratory Cat# 002116 β2M − /− The Jackson Laboratory Cat# 002087 I-Ab − /− The Jackson Laboratory Cat# 005589 Rag2 − /− The Jackson Laboratory Cat# 008449 Ifnγ − /− The Jackson Laboratory Cat# 002287 Perforin-1 − /− The Jackson Laboratory Cat# 002407 Ifnar1 − /− The Jackson Laboratory Cat# 028288 Ccr2 − /− The Jackson Laboratory Cat# 004999 iNOS − /− The Jackson Laboratory Cat# 002609 ΔΔGata1 The Jackson Laboratory Cat# 005653 Δ1+2 + 3 The Jackson Laboratory Cat# 037704 OT-II The Jackson Laboratory Cat# 004194 TRP1high Dana-Farber Cancer Institute (bred in-house) RRID:IMSR_JAX:030958 TCRδ− /− The Jackson Laboratory Cat# 002120 Mr1− /− TCRδ− /− Dana-Farber Cancer Institute (bred in-house) CD11ccre The Jackson Laboratory Cat# 008068 LysMcre The Jackson Laboratory Cat# 004781 MHC-IIfl/fl The Jackson Laboratory Cat# 037709 CD11ccre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) LysMcre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) Tbx21− /− The Jackson Laboratory Cat# 004648 Oligonucleotides Caspase-8 sgRNA Doench et al.89 CAAGAAGCAGGAGACCATCG (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–20.e1–e9, July 13, 2026 e3 ..

    Immunopeptidomics:

    Article Title: Dendritic cell redundancy enables priming of anti-tumor CD4 + T cells in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER anti-CD45 PE-CF594 BD Biosciences Cat# 562279; RRID: AB_11154577 anti-CD34 Brilliant Violet 510 BioLegend Cat# 343528; RRID: AB_2563856 anti-CD20 Pacific Blue BioLegend Cat# 302328; RRID: AB_1595435 anti-CD3 Pacific Blue BioLegend Cat# 300418; RRID: AB_493095 anti-CD14 Pacific Blue BioLegend Cat# 301828; RRID: AB_2275670 anti-CD16 Pacific Blue BioLegend Cat# 302032; RRID: AB_2104003 anti-CD19 Pacific Blue BioLegend Cat# 302232; RRID: AB_2073118 anti-HLA-DR Brilliant Violet 711 BioLegend Cat# 307643; RRID: AB_11218794 anti-CD45RA PE-Cy7 BioLegend Cat#304126; RRID: AB_10708879 anti-CD33 FITC BioLegend Cat# 366620; RRID: AB_2566422 anti-CD123 Brilliant Violet 605 BD Biosciences Cat# 740412; RRID: AB_2740142 anti-CADM1 Alexa Fluor 647 MBL International Cat# CM004-A64; RRID: AB_3107120 anti-CD1c PE BioLegend Cat# 331506; RRID: AB_1088999 Bacterial and virus strains DH5α Life Technologies Cat# 18265017 Biological samples Human PDAC Tissue This paper Human PDAC patient blood This paper Chemicals, peptides, and recombinant proteins STING agonist Bristol Myers Squibb BMS-986301 BsmBI NEB Cat# R0739S BbsI NEB Cat# R3539S T4 DNA ligase NEB Cat# M0202L Lipofectamine ThermoFisher Cat# 13778075 OptiMEM Life Technologies Cat# 31985062 Trypsin Life Technologies Cat# 25200114 Protease and phosphatase inhibitor Sigma Cat# 11836170001 BCA Assay kit Life Technologies Cat# 23225 FTY720 Sigma Cat# SML0700 Dispase Life Technologies Cat# 17105041 Collagenase P Sigma Cat# 11249002001 DNase I Sigma Cat# 10104159001 IFNγ Peprotech Cat# 315-05 ІFNβ BioLegend Cat# 581302 IFNα BioLegend Cat# 752804 Qiagen RNAeasy Plus Mini Kit Qiagen Cat# 74134 hIL-2 Peprotech Cat# 200-02 ISQAVHAAHAEINEAGR in-house generated TAPDNLGYM (M9) Clancy-Thompson et al.70 STEMCELL EasySep CD4 Negative Selection Kit STEMCELL Cat# 19852 STEMCELL EasySep CD8 Negative Selection Kit STEMCELL Cat# 19853 Brefeldin A Sigma Cat# B7651 Collagenase IV Sigma Cat# C5138 Soybean trypsin inhbitor Life Technologies Cat# 17075029 Tumor dissociation kit Miltenyi Cat# 130-095-929 Critical commercial assays Micro BCA Kit Fisher Scientific Cat# PI23235 (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–20.e1–e9, July 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse IFNγ ELISpot Fisher Scientific Cat# BDB551083 Mouse IFNα ELISA Life Technologies Cat# BMS6027 Deposited data Loveless et al. data Loveless et al.74 https://zenodo.org/records/14199536 Hwang et al. data Hwang et al.75 GEO# GSE202051 DFCI human single-cell RNA sequencing This paper dbGAP: phs004508 dbGAP: phs004257 Mouse single-cell and bulk RNA sequencing This paper GEO: GSE325195 Experimental models: Cell lines Mouse: 6694c2 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM31 Mouse: 6419c5 Ben Stanger (University of Pennsylvania) RRID: CVCL_YM21 Mouse: 6694c2 β2m− /− Roehle et al.56 Mouse: 6694c2 Ciita− /− This paper Mouse: 6694c2 Caspase-8− /− This paper Mouse: 6694c2COVA This paper Mouse 6694c2 Stat1− /− This paper Mouse: 6694c2 Ifnγr1− /− This paper Mouse: 6694c2-met Qiang et al.58 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory Cat# 000664 Mouse: μMT − /− The Jackson Laboratory Cat# 002249 Mouse: Batf3 − /− The Jackson Laboratory Cat# 013755 TCRα − /− The Jackson Laboratory Cat# 002116 β2M − /− The Jackson Laboratory Cat# 002087 I-Ab − /− The Jackson Laboratory Cat# 005589 Rag2 − /− The Jackson Laboratory Cat# 008449 Ifnγ − /− The Jackson Laboratory Cat# 002287 Perforin-1 − /− The Jackson Laboratory Cat# 002407 Ifnar1 − /− The Jackson Laboratory Cat# 028288 Ccr2 − /− The Jackson Laboratory Cat# 004999 iNOS − /− The Jackson Laboratory Cat# 002609 ΔΔGata1 The Jackson Laboratory Cat# 005653 Δ1+2 + 3 The Jackson Laboratory Cat# 037704 OT-II The Jackson Laboratory Cat# 004194 TRP1high Dana-Farber Cancer Institute (bred in-house) RRID:IMSR_JAX:030958 TCRδ− /− The Jackson Laboratory Cat# 002120 Mr1− /− TCRδ− /− Dana-Farber Cancer Institute (bred in-house) CD11ccre The Jackson Laboratory Cat# 008068 LysMcre The Jackson Laboratory Cat# 004781 MHC-IIfl/fl The Jackson Laboratory Cat# 037709 CD11ccre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) LysMcre MHC-IIfl/fl Dana-Farber Cancer Institute (bred in-house) Tbx21− /− The Jackson Laboratory Cat# 004648 Oligonucleotides Caspase-8 sgRNA Doench et al.89 CAAGAAGCAGGAGACCATCG (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–20.e1–e9, July 13, 2026 e3 ..



    Similar Products

    86
    Fisher Scientific resource source identifier mouse ifnγ elispot fisher scientific
    Resource Source Identifier Mouse Ifnγ Elispot Fisher Scientific, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+mouse+ifn%CE%B3+elispot+fisher+scientific/ifn+%CE%B2/pm42102812-773-2-8
    Average 86 stars, based on 1 article reviews
    resource source identifier mouse ifnγ elispot fisher scientific - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    Image Search Results